3 Comments

Go to the profile of relaxin
relaxin 6 months ago

GFP forward, 5'-AAGCTGACCCTGAAGTTCATCTGC-3', and reverse, 5'-CTTGTAGTTGCCGTCGTCCTTGAA-3',

These PCR primers are obtained online, please double check with your own sequence.

Go to the profile of patriciathomas
patriciathomas 6 months ago

GFP stands for green fluorescent protein reporter strains were inoculated into mice in a disseminated candidiasis model, and GFP production was monitored by immuno histochemistry and reverse transcription-PCR (RT-PCR). GFP production from the ALS1 and ALS3 promoters was detected immunohistochemically. ALS1, ALS2, ALS3, ALS4, and ALS9 transcription was detected by RT-PCR. I would probably Use eGFP N:CTGGTCGAGCTGGACGGCGACG eGFP C:CATGGTCCTGCTGGAGTTCGTG to sequence them.

Go to the profile of OldCloner
OldCloner 6 months ago

Just make sure you know exactly which GFP you are trying to amplify or sequence- there are a lot of variations and though the proteins have similar properties, the nucleotide sequences can be way different. This is because GFP genes have been extracted from various, very distantly related species from Jellyfish to copepods! Good luck!